A TI{KozakGAL4} DNA cassette has been inserted into IntS9, replacing the coding sequence (coordinates of deleted sequence are 3L:16103459..16105579 , release 6 genome). This results in a simultaneous knock-out of IntS9 plus a knock-in of GAL4 that is expected to be expressed under the control of the endogenous regulatory sequences of IntS9 (predicted to gene trap all annotated transcripts of the gene). The deletion also removes part of IleRS-m. The TI{KozakGAL4} cassette was inserted via the CRISPR/Cas-9 drop-in technique, using a dsDNA donor vector with homology arms of length 200bp. The sgRNA sequences used to target the gene were: CATCGTCTAATCGGCACTGTCGG and TGTGTTGTTATTTAGGTGTAAGG.