FB2024_03 , released June 25, 2024
Aberration: Dmel\Df(2L)CRIMIC-CR70590
Open Close
General Information
Symbol
Df(2L)CRIMIC-CR70590
Species
D. melanogaster
Name
FlyBase ID
FBab0049364
Feature type
Computed Breakpoints include
Sequence coordinates
2L:19,033,691..19,033,691 (Df(2L)CRIMIC-CR70590:bk1)
2L:19,034,490..19,034,490 (Df(2L)CRIMIC-CR70590:bk2)
Member of large scale dataset(s)
Nature of Aberration
Cytological Order
Progenitor
Class of aberration (relative to wild type)
Class of aberration (relative to progenitor)
Breakpoints
Carries alleles
Formalized genetic data
Genetic mapping information
Comments

A TI{KozakGAL4} DNA cassette has been inserted into CG31800, replacing the coding sequence (coordinates of deleted sequence are 2L:19033691..19034490 , release 6 genome). This results in a simultaneous knock-out of CG31800 plus a knock-in of GAL4 that is expected to be expressed under the control of the endogenous regulatory sequences of CG31800 (predicted to gene trap all annotated transcripts of the gene). The deletion also removes part of mib2. The TI{KozakGAL4} cassette was inserted via the CRISPR/Cas-9 drop-in technique, using a dsDNA donor vector with homology arms of length 200bp. The sgRNA sequences used to target the gene were: TACTTATTTGTATTCATGTTCGG and TATCAGTAACATCGAAGTTTGGG.

Comments on Cytology
Sequence Crossreferences
DNA sequence
Protein sequence
Gene Deletion and Duplication Data
Genes Deleted / Disrupted
Complementation Data
Completely deleted / disrupted
Partially deleted / disrupted
Molecular Data
Completely deleted
Genes NOT Deleted / Disrupted
Complementation Data
 
Molecular Data
 
Genes Duplicated
Complementation Data
Completely duplicated
Partially duplicated
Molecular Data
Completely duplicated
Partially duplicated
Genes NOT Duplicated
Complementation Data
 
Molecular Data
 
Affected Genes Inferred by Location (2)
Phenotypic Data
In combination with other aberrations
NOT in combination with other aberrations
Stocks (1)
Notes on Origin
Discoverer
 
Balancer / Genotype Variants of the Aberration
 
Separable Components
 
Other Comments
 
Synonyms and Secondary IDs (1)
Reported As
Symbol Synonym
Df(2L)CRIMIC-CR70590
Name Synonyms
Secondary FlyBase IDs
    References (1)