A TI{KozakGAL4} DNA cassette has been inserted into CG14210, replacing the coding sequence (coordinates of deleted sequence are X:19616196..19616761 , release 6 genome). This results in a simultaneous knock-out of CG14210 plus a knock-in of GAL4 that is expected to be expressed under the control of the endogenous regulatory sequences of CG14210 (predicted to gene trap all annotated transcripts of the gene). The deletion also removes part of is also within Pstk and part of Tim9b. The TI{KozakGAL4} cassette was inserted via the CRISPR/Cas-9 drop-in technique, using a dsDNA donor vector with a 3' homology arm of length 200bp and the 5' homology arm extended to restore the promoter. The sgRNA sequences used to target the gene were: TTGTGAAAGCCATCGGTGATCGG and CAGGTGAAGGTGGTCTGAGGTGG.