A TI{KozakGAL4} DNA cassette has been inserted into Bace, replacing the coding sequence (coordinates of deleted sequence are 2L:8495090..8496271 , release 6 genome). This results in a simultaneous knock-out of Bace plus a knock-in of GAL4 that is expected to be expressed under the control of the endogenous regulatory sequences of Bace (predicted to gene trap all annotated transcripts of the gene). The deletion also removes part of Dh31. The TI{KozakGAL4} cassette was inserted via the CRISPR/Cas-9 drop-in technique, using a dsDNA donor vector with homology arms of length 200bp. The sgRNA sequences used to target the gene were: GATGGTCTTGAACATTCTCTTGG and CTTGAGGTGACCCAGACATTTGG.