A mutation caused by an imprecise excision event; 38 bases of P element remain as well as the 8bp target site duplication. The insertion results in a premature stop codon after the first 15 residues of the predicted protein.
CATGATGAAATAACATGTTATTTCATCATGGTCTGGGG
ms(3)K811/Df(3R)ms(3)K81-2 males are sterile.
Paternal chromosomes are unable to separate sister chromatids during the first zygotic division of embryos derived from wild-type females crossed to homozygous males and they form a chromatin bridge that stretches between the spindle poles. The maternally derived chromatids separate normally during the first zygotic division. In metaphase of the second zygotic division, paternal chromatin typically bridges between the two haploid nuclei that contain maternally derived chromosomes.
When wild type females are mated to homozygous ms(3)K811 males the progeny fall into two groups: most arrest in early nuclear cycles and the rest develop as haploids and die before hatching. The events of sperm decondensation, pronuclear migration, and alignment leading to the first mitotic division are not different from wild type, but anaphase is abnormal. Chromosome bridges are stretched between the poles. Anaphase bridges are also observed in subsequent mitoses.
Homozygous males produce motile sperm capable of fertilizing eggs, but defective in pronuclear function. Development of fertilized eggs initiated; arrested after several nuclear divisions in three-fourths of the embryos, the remainder developing beyond blastoderm and proving to be haploid upon cytological examination. Nuclear division cycle protracted compared to wild type and the syncytial blastoderm nuclei undergo an extra division to produce twice the normal density prior to cellularization (Edgar, Kiehle and Schuberger, 1986). A small fraction of the eggs diploidize and yield viable daughters, mostly by fusion of products of the first meiotic division (85%); fusion of products of second meiotic division rare or nonexistent. Incidence of gynogenetic diploids becomes appreciable in crosses to a stock designated G9 by Fuyama (1986). male-sterile
ms(3)K811 is rescued by ms(3)K81GFP
ms(3)K811 is rescued by ms(3)K81+t1.781
Df(3R)ms(3)K81-2/ms(3)K811 is rescued by ms(3)K81+t1.781
ms(3)K81T:Avic\GFP fully rescues the sterility of homozygous ms(3)K811 males.