A TI{KozakGAL4} DNA cassette has been inserted into CG5157, replacing the coding sequence (coordinates of deleted sequence are 3L:16136700..16137213 , release 6 genome). This results in a simultaneous knock-out of CG5157 plus a knock-in of GAL4 that is expected to be expressed under the control of the endogenous regulatory sequences of CG5157 (predicted to gene trap all annotated transcripts of the gene). The TI{KozakGAL4} cassette was inserted via the CRISPR/Cas-9 drop-in technique, using a dsDNA donor vector with homology arms of length 200bp. The sgRNA sequences used to target the gene were: AACACTGGACGCGTGCCAAGGGG and TTTCTGTTGCTGCTAGTCATAGG. The 3' end of the deletion associated with the insertion is 9 bp downstream of the 3' end of the elg1 gene and may affect the proper 3' end formation of its transcripts.