GGCCTCGCAGTTTTTCACCGAAAAGGTTTTGTAAAAACACCGTGCCAAACTGTCAGAGAAGCAGCCGCTTGCAAGCCAAC CGCTTAAATGTCACAGCATTCCTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
Fly gonads were isolated from embryos carrying EGFP-vasa transgene that express GFP only in pole cells by using fluorescence-activated cell sorting (FACS).
Total RNA was extracted from the isolated gonads at embryonic stages 13-16 by using RNeasy Mini kit (QIAGEN). Poly(A)+ RNA was purified Oligotex dT30 (TaKaRa) from the total RNA. cDNA was synthesized and amplified by Long-Distance PCR using SMART technology (Clontech) and directionally cloned into pDNR-LIB vector (Clontech). cDNA inserts are flanked by linker sequences 5'-GGCCATTACGGCCGGG-3' (5' linker: SMART IV Oligonucleotide, Clontech) and 5'-polyA-CATGTCGGCCGCCTCGGCC-3' (3' linker: CDSIII/3' PCR Primer, Clontech).