>From smount@XXXX Tue May 30  03:52:01  2000
Envelope-to: ma11@XXXX
Delivery-date: Tue, 30 May 2000  03:52:01  +0100
X-Authentication-Warning: rac5.wam.umd.edu: smount owned process doing -bs
Date: Mon, 29 May 2000  22:57:23  -0400 (EDT)
From: Stephen M Mount <smount@XXXX>
To: Michael Ashburner <ma11@XXXX>
Subject: Re: snRNA report - some questions
MIME-Version: 1.0
Michael,
Sorry to be so slow in responding. I think that I explained the basis of
my naming and addressed all of the U-RNAs last time. The questions I did
not address are below:
> 7. I think I asked you this before: Any idea what these are ?
>
> \*a snRNA-a
> \*z FBgn0003454
> \*x FBrf0042443 == Arrigo et al., 1985, EMBO J. 4: 399--406
> \*g M26817
AE003241 446-506 is a pretty good match. This same sequence is in
>gb|M21017.1|DRORGAB D.melanogaster 18S, 5.8S 2S and 28S rRNA genes,
complete, and 18S  rRNA gene, 5' end, clone pDm238.
This is 95% identical to the 5' end of 18S rRNA.
> \#
> \*a snRNA-b
> \*z FBgn0003455
> \*x FBrf0042443 == Arrigo et al., 1985, EMBO J. 4: 399--406
> \*g M26818
> \#
This sequence is not in the genome, but it is somewhat similar to U6
(82%). Could it just be U6 sequenced badly? E = 0.05. It is not supposed
to be in the cytoplasm (except transiently).
> \*a snRNA-c
> \*z FBgn0003456
> \*x FBrf0042443 == Arrigo et al., 1985, EMBO J. 4: 399--406
> \*g M26819
> \#
This is not in the Celera genome, either, and doesn't resemble anything
enough for comment.
> \*a snRNA-d
> \*z FBgn0003457
> \*x FBrf0042443 == Arrigo et al., 1985, EMBO J. 4: 399--406
> \*g M26820
> \#
This is 90% identical to a piece of the mitochondrial genome,
>gb|U37541.1|DMU37541
Query: 2     aaattttatatttaaattattatataaaaatgtaactcgagat-aaaaaactt 53
             ||||||||||||||||||||||||||||||||||| | ||| | |||||| ||
Sbjct: 14648 aaattttatatttaaattattatataaaaatgtaatt-gaggttaaaaaattt 14597
-------------
The RNAs in this Wooley paper were not characterized sufficiently for
positive identification. The only one in GenBank is K5, which is U1 (with
two mistakes in 131 nucleotides, which is not bad for that methodology).
> \*a  snRNA:K2a 
> \*z FBgn0016982
> \*x FBrf0038653 == gm626.h == Wooley et al., 1982, Proc. Natl. Acad. Sci. USA 79(22): 6762--6766
> \#
> \*a  snRNA:K2b 
> \*z FBgn0016981
> \*x FBrf0038653 == gm626.h == Wooley et al., 1982, Proc. Natl. Acad. Sci. USA 79(22): 6762--6766
> \#
> \*a  snRNA:K8 
> \*z FBgn0016980
> \*x FBrf0038653 == gm626.h == Wooley et al., 1982, Proc. Natl. Acad. Sci. USA 79(22): 6762--6766
> \#
> \*a  snRNA:K9 
> \*z FBgn0016979
> \*x FBrf0038653 == gm626.h == Wooley et al., 1982, Proc. Natl. Acad.
> Sci. USA 79(22): 6762--6766
> \#
>
Stephen M. Mount
Cell Biology and Molecular Genetics
H. J. Patterson Hall
University of Maryland
College Park, MD    20742-5815
Phone      301-405-6934
FAX        301-314-9081
permanent email address        sm193@XXXX