From: kercook@XXXX Subject: Isolation and characterization of Df(3R)BSC852 Date: 22 July 2009 19:10:24 BST To: flybase-cambridgeXXXX, ruacookXXXX Isolation and characterization of Df(3R)BSC852 Stacey Christensen, Kim Cook and Kevin Cook Bloomington Stock Center Indiana University Df(3R)BSC852 was isolated as a FLP recombinase-induced recombination event involving PBac{WH}CG11859f03457 and P{XP}d00503. The deletion was isolated as a chromosome lacking miniwhite markers in progeny of w1118; P{hs-hid}3, Dr1/TM6C, Sb1 cu1 females crossed to P{hsFLP}1, y1 w1118; PBac{WH}CG11859f03457/P{XP}d00503 males. The males were heat shocked as larvae as described in Parks et al., Nature Genetics 36: 288-292, 2004 (FBrf0175003). This cross and crosses in preceding and succeeding generations maintained the original genetic background of the Exelixis insertion stocks (Thibault et al., Nature Genetics 36: 283-287, 2004; FBrf0175002). The recombination event generated the genetic element P+PBac{XP5.WH5}BSC852 from the segment of PBac{WH}CG11859f03457 to the left of its FRT site and the segment of P{XP}d00503 to the right of its FRT site. Its presence was verified using the PCR methods and primers described in Parks et al. The breakpoints of Df(3R)BSC852 predicted from the Release 5 genomic coordinates of the transposable element insertion sites are 3R:21092436 ;21129873 and the cytological breakpoints predicted from these coordinates are 96C8;96D1. To confirm the presence of the deficiency, we showed that a 735 base pair fragment spanning the PBac{PB}CG11892c00398 (FBti0040869 ) insertion site could not be amplified from Df(3R)BSC852/PBac{PB}CG11892c00398 flies using primers 5’- GCATCCCTAAATCCACAGCAGGTGC -3’ and 5’-GCGAACTCATTCCCCTCAAATGTGG-3’. -- Kevin Cook, Ph.D. Bloomington Drosophila Stock Center Department of Biology Indiana University 1001 E. Third St. Bloomington, IN 47405-7005 kercook@XXXX 812-856-1213 (office), 812-855-2577 (fax) http://flystocks.bio.indiana.edu
