The intronic sequence around Ance-31 are: gtttcgtttttgtttatctctggtctgcacg the last c is mutated to an a (acc—>aag) For Ance-33 the sequence immediately upstream of the deletion is GTGGCATTTTTACCTTTTGCATTATCTCTG The sequence just past the deletion is GCTGCATAACCAGAGCAATTAAAGCGTCTAGCAGC For Ance-3KO (reported as ance-3RFP), the sequence of the CRISPR upstream is CAACGGCGACCTTGGCAGTGTGG-the PAM site is underlined-this is 30 bp upstream of the ATG. The downstream CRISPR site is GCAATTAAAGCGTCTTAGCAGCGG.