FB2024_03 , released June 25, 2024
Aberration: Dmel\Df(3R)BSC852
Open Close
General Information
Symbol
Df(3R)BSC852
Species
D. melanogaster
Name
FlyBase ID
FBab0045966
Feature type
Genomic Maps
Sequence coordinates
3R:25,266,714..25,266,714 (Df(3R)BSC852:bk1)
3R:25,304,151..25,304,151 (Df(3R)BSC852:bk2)
Member of large scale dataset(s)
Dfs_BSC_set2

A set of ~800 largely isogenic deficiency stocks created by FLP-induced recombination between FRT-carrying transgenic insertions; molecularly defined deletion endpoints correspond to initial location of the progenitor insertions. Designed to fill gaps in deletion coverage and breakpoint placement; also used to replace older available deficiencies that have not been molecularly mapped.

Nature of Aberration
Cytological Order
Class of aberration (relative to wild type)
Class of aberration (relative to progenitor)
Breakpoints
Causes alleles
Carries alleles
Formalized genetic data
Genetic mapping information
Comments
Comments on Cytology

The breakpoints of Df(3R)BSC852 predicted from the Release 5 genomic coordinates of the progenitor transposable element insertion sites are 3R:21092436 ;21129873 and the cytological breakpoints predicted from these coordinates are 96C8;96D1. To confirm the presence of the deficiency, a 735 base pair fragment spanning the PBac{PB}CG11892[c00398] (FBti0040869) insertion site could not be amplified from Df(3R)BSC852/PBac{PB}CG11892[c00398] flies using primers 5’- GCATCCCTAAATCCACAGCAGGTGC -3’ and 5’-GCGAACTCATTCCCCTCAAATGTGG-3’.

Sequence Crossreferences
DNA sequence
Protein sequence
Gene Deletion and Duplication Data
Genes Deleted / Disrupted
Complementation Data
Completely deleted / disrupted
Partially deleted / disrupted
Molecular Data
Completely deleted
Partially deleted
Genes NOT Deleted / Disrupted
Complementation Data
 
Molecular Data
 
Genes Duplicated
Complementation Data
Completely duplicated
Partially duplicated
Molecular Data
Completely duplicated
Partially duplicated
Genes NOT Duplicated
Complementation Data
 
Molecular Data
 
Affected Genes Inferred by Location (21)
Phenotypic Data
In combination with other aberrations
NOT in combination with other aberrations
Stocks (1)
Notes on Origin
Discoverer
 
Balancer / Genotype Variants of the Aberration
 
Separable Components
 
Other Comments
 

The presence of P+PBac{XP5.WH5}BSC852 was verified using the PCR methods and primers described in FBrf0175003.

Synonyms and Secondary IDs (1)
Reported As
Name Synonyms
Secondary FlyBase IDs
    References (5)