A set of ~800 largely isogenic deficiency stocks created by FLP-induced recombination between FRT-carrying transgenic insertions; molecularly defined deletion endpoints correspond to initial location of the progenitor insertions. Designed to fill gaps in deletion coverage and breakpoint placement; also used to replace older available deficiencies that have not been molecularly mapped.
The presence of P+PBac{XP5.WH5}BSC852 was verified using the PCR methods and primers described in FBrf0175003.
The breakpoints of Df(3R)BSC852 predicted from the Release 5 genomic coordinates of the progenitor transposable element insertion sites are 3R:21092436 ;21129873 and the cytological breakpoints predicted from these coordinates are 96C8;96D1. To confirm the presence of the deficiency, a 735 base pair fragment spanning the PBac{PB}CG11892[c00398] (FBti0040869) insertion site could not be amplified from Df(3R)BSC852/PBac{PB}CG11892[c00398] flies using primers 5’- GCATCCCTAAATCCACAGCAGGTGC -3’ and 5’-GCGAACTCATTCCCCTCAAATGTGG-3’.