UAS regulatory sequences drive expression of an shRNA that targets the mbl circular RNA (circRNA) (the targeted sequence is CAGCATCAAGATAATGTAAAC). (The pVALIUM20 vector was used to generate this transgene).
abnormal flight | male, with Scer\GAL4Act5C.PU
abnormal locomotor behavior | adult stage, with Scer\GAL4Act5C.PU
abnormal locomotor behavior | larval stage, with Scer\GAL4Act5C.PU
partially lethal | male, with Scer\GAL4Act5C.PU
visible | adult stage, with Scer\GAL4Act5C.PU
wing, with Scer\GAL4Act5C.PU