A TI{KozakGAL4} DNA cassette has been inserted into Pngl, replacing the coding sequence (coordinates of deleted sequence are 2R:6017811..6019956 , release 6 genome). This results in a simultaneous knock-out of Pngl plus a knock-in of GAL4 that is expected to be expressed under the control of the endogenous regulatory sequences of Pngl (predicted to gene trap all annotated transcripts of the gene). The TI{KozakGAL4} cassette was inserted via the CRISPR/Cas-9 drop-in technique, using a dsDNA donor vector with homology arms of length 200bp. The sgRNA sequences used to target the gene were: CGACGAAACCAATCTGATAGTGG and GGCAACACACACAACTGTTCAGG.
PnglPL/PnglCR70053-KO-kG4 has increased mortality during development phenotype, suppressible | partially by sggJF01255/Scer\GAL4Pngl-CR70053-KO-kG4