Imprecise excision of the progenitor insertion (P{lacW}Thork13517) has resulted in a deletion that removes the entire Thor coding region. A 27bp fragment of the original P{lacW} element remains.
A 1579bp deletion resulting from the imprecise excision of P{lacW}Thork13517 removes the Thor coding region. 27 bases of the insertion (CATGATGAAATAACATATCAGATCATG) remain at the site of the excision. The deletion coordinates were determined from the reported junction sequences.
CATGATGAAATAACATATCAGATCATG
ThorΔ1034-2617 has no effect on the increase in sleep duration seen in wild type flies in response to rapamycin.
The life-span of ThorΔ1034-2617 flies is significantly shorter in comparison to revertant ThorRv1 control flies. The median life-span of mutant males is 19.8 days, approximately 25% shorter than that of control males (26.6 days). The life-span of females is longer than in males, but a comparable relative effect of the ThorΔ1034-2617 mutation on life-span is observed in both sexes. ThorΔ1034-2617 larvae die substantially faster than their control counterparts under starvation (median life-span of 20.8 hours for starved ThorΔ1034-2617 larvae, 26.2 hours for wild-type). ThorΔ1034-2617 flies exhibit a reduced life-span when exposed to 5% hydrogen peroxide-containing media (median life-span of 23.2 hours). No ThorΔ1034-2617 flies survived 60 hours after exposure to oxidative stress, compared to 66.1% in wild-type.
ThorΔ1034-2617 is a suppressor of viable | pupal stage phenotype of eIF4E107238/eIF-4E[+], parkP23
The pupal lethality observed in parkP23/parkP23 mutant animals is suppressed in a eIF-4E07238/+ background. Pupal lethality is restored in ThorΔ1034-2617/ThorΔ1034-2617; parkP23, eIF-4E07238/parkP23 animals.
eIF-4E07238/+ significantly abrogates the oogenesis defects in parkP23/parkP23 mutant females. Oogenesis defects are not restored in ThorΔ1034-2617/ThorΔ1034-2617; parkP23, eIF-4E07238/parkP23 mutant animals.
ThorΔ1034-2617 is rescued by ThorUAS.cTa/Scer\GAL4hs.PB
ThorΔ1034-2617 is not rescued by ThorY54A.M59A.UAS/Scer\GAL4hs.PB
Expression of ThorScer\UAS.cTa under the control of Scer\GAL4hs.PB rescues the increased sensitivity of ThorΔ1034-2617 larvae to starvation. Expression of ThorY54A.M59A.Scer\UAS, under the control of Scer\GAL4hs.PB does not rescue the increased sensitivity of ThorΔ1034-2617 larvae to starvation. Expression of ThorScer\UAS.cTa under the control of Scer\GAL4hs.PB rescues oxidative stress sensitivity (median life-span of 55.4 hours). Expression of ThorY54A.M59A.Scer\UAS under the control of Scer\GAL4hs.PB does not rescue oxidative stress sensitivity (median life-span of 24.1 hours, 0.4% survival rate at 60 hours).