Imprecise excision of the progenitor insertion, resulting in a 1.2kb deletion that removes the first three exons of Hand.
AATAACTTACAATAAAGTAGTAC
The 1.2kb annotated region is deleted and replaced by 23bp in Hand173 allele.
short lived (with Df(2L)J1)
short lived (with Handko)
The morphology of the dorsal vessel appears normal in homozygous embryos and the visceral musculature does not appear to be grossly altered in homozygous embryos and larvae. However, the lymph gland is either absent or reduced in a large proportion of the mutant embryos.
Homozygous, Hand173/Handko and Hand173/Df(2L)J1 adults suffer a high rate of premature mortality.
The dorsal vessels of homozygous adults are clearly disorganised, with the myofibrils bent around the cortex of each cardioblast outside of the nucleus. Both the diastolic and systolic widths of the Hand173/Df(2L)J1 adult dorsal vessel are significantly reduced compared to controls, as is the ratio of these widths (this will result in a large decrease in the stroke volume of the mutant hearts). The heartbeat rates of the mutant adults are similar to those of controls, however, while the heartbeat contractions still propagate anteriorly, they appear to originate anywhere along the length of the heart, in contrast to normal hearts where they initiate in the posterior.
Homozygous adults have severe defects in the digestive tract, particularly in the midgut; the most common defects are a pronounced bulging and occasional rupturing of the anterior midgut immediately posterior of the proventriculus, coupled with a shortening of the length of the midgut by approximately 25-50%, a variable narrowing of the mid- and posterior midgut and a distended crop. Defects in the circular and longitudinal visceral musculature are seen in those regions of the gut with abnormal morphology. In the most severely affected mutant adults, extremely long loops of a single continuous peritrophic membrane tubule are seen external to the gut, packed into the abdominal cavity.