UAS regulatory sequences (from the pWALIUM22 vector) drive expression of a shRNA that targets the shot EGC domain (targets the sequence CCGGAAAATGGATAAGGATAA). This targets all 22 isoforms of shot.
decreased size | oogenesis, with Scer\GAL4VP16.mat.αTub67C
decreased size | oogenesis, with Scer\GAL4VP16.mat.αTub67C, shotΔEGC
egg chamber, with Scer\GAL4VP16.mat.αTub67C
female germline ring canal, with Scer\GAL4VP16.mat.αTub67C
microtubule | decreased number | oogenesis, with Scer\GAL4VP16.mat.αTub67C
nurse cell, with Scer\GAL4VP16.mat.αTub67C
oocyte, with Scer\GAL4VP16.mat.αTub67C
oocyte, with Scer\GAL4VP16.mat.αTub67C, shotΔEGC
oocyte nucleus, with Scer\GAL4VP16.mat.αTub67C
ooplasm, with Scer\GAL4VP16.mat.αTub67C