A TI{KozakGAL4} DNA cassette has been inserted into CG8320, replacing the coding sequence (coordinates of deleted sequence are 2R:15992652..15993441 , release 6 genome). This results in a simultaneous knock-out of CG8320 plus a knock-in of GAL4 that is expected to be expressed under the control of the endogenous regulatory sequences of CG8320 (predicted to gene trap all annotated transcripts of the gene). The TI{KozakGAL4} cassette was inserted via the CRISPR/Cas-9 drop-in technique, using a dsDNA donor vector with homology arms of length 200bp. The sgRNA sequences used to target the gene were: AGACGTCGCCACGTAAATAGTGG and CGAGTTGGCCTGGTGGTTAAGGG.
lethal (with Tmem208sfGFP)
visible | adult stage (with Df(2R)Exel7138)
wing (with Df(2R)Exel7138)
Df(2R)Exel7138/Tmem208CR70040-KO-kG4 has increased mortality during development phenotype, suppressible by Hsap\TMEM208UAS.Tag:HA/Scer\GAL4Tmem208-CR70040-KO-kG4
Df(2R)Exel7138/Tmem208CR70040-KO-kG4 has increased mortality during development phenotype, suppressible | partially by Hsap\TMEM208L27P.UAS.Tag:HA/Scer\GAL4Tmem208-CR70040-KO-kG4
Df(2R)Exel7138/Tmem208CR70040-KO-kG4 has abnormal planar polarity | adult stage phenotype, suppressible by Hsap\TMEM208UAS.Tag:HA/Scer\GAL4Tmem208-CR70040-KO-kG4
Df(2R)Exel7138/Tmem208CR70040-KO-kG4 has abnormal planar polarity | adult stage phenotype, suppressible | partially by Hsap\TMEM208F59fs13.UAS.Tag:HA/Scer\GAL4Tmem208-CR70040-KO-kG4
Df(2R)Exel7138/Tmem208CR70040-KO-kG4 has abnormal planar polarity | adult stage phenotype, suppressible | partially by Hsap\TMEM208L27P.UAS.Tag:HA/Scer\GAL4Tmem208-CR70040-KO-kG4
Df(2R)Exel7138/Tmem208CR70040-KO-kG4 has bang sensitive phenotype, suppressible by Hsap\TMEM208UAS.Tag:HA/Scer\GAL4Tmem208-CR70040-KO-kG4
Df(2R)Exel7138/Tmem208CR70040-KO-kG4 has partially lethal - majority die phenotype, non-suppressible by Hsap\TMEM208F59fs13.UAS.Tag:HA/Scer\GAL4Tmem208-CR70040-KO-kG4
Df(2R)Exel7138/Tmem208CR70040-KO-kG4 has wing hair phenotype, suppressible by Hsap\TMEM208UAS.Tag:HA/Scer\GAL4Tmem208-CR70040-KO-kG4
Df(2R)Exel7138/Tmem208CR70040-KO-kG4 has wing hair phenotype, suppressible | partially by Hsap\TMEM208L27P.UAS.Tag:HA/Scer\GAL4Tmem208-CR70040-KO-kG4
Df(2R)Exel7138/Tmem208CR70040-KO-kG4 has wing hair phenotype, suppressible | partially by Hsap\TMEM208F59fs13.UAS.Tag:HA/Scer\GAL4Tmem208-CR70040-KO-kG4