[];[]
Inferred to overlap with: Df(2R)ED1.
Lethal in combination with Df(2R)ED1.
Lethal in combination with Df(2R)ED1. Lethal in combination with In(2LR)DTD99.
Deletion extending from the 3' end of the P{lacW}GstS1k08805 insertion to a site within the coding sequence of the Ark gene. The P{lacW} element sequence is adjacent to the sequence GGTTTAGCAATTATTACTTTATTT within the Ark gene. The 5' and 3' ends of the P{lacW} element are present and non-rearranged (determined by DNA sequencing) and the w+mC marker within the element is still present (as judged by phenotype).