FB2024_03 , released June 25, 2024
Aberration: Dmel\Df(2R)P803-Δ15
Open Close
General Information
Symbol
Df(2R)P803-Δ15
Species
D. melanogaster
Name
FlyBase ID
FBab0029691
Feature type
Also Known As
Df(2R)P803-Delta15
Computed Breakpoints include
Sequence coordinates
Member of large scale dataset(s)
Nature of Aberration
Cytological Order
Class of aberration (relative to wild type)
Class of aberration (relative to progenitor)
Breakpoints
Carries alleles
Transposon Insertions
Formalized genetic data
Genetic mapping information
Comments
Comments on Cytology
Sequence Crossreferences
DNA sequence
Protein sequence
Gene Deletion and Duplication Data
Genes Deleted / Disrupted
Complementation Data
Partially deleted / disrupted
Molecular Data
Completely deleted
Partially deleted
Genes NOT Deleted / Disrupted
Complementation Data
Molecular Data
 
Genes Duplicated
Complementation Data
Completely duplicated
Partially duplicated
Molecular Data
Completely duplicated
Partially duplicated
Genes NOT Duplicated
Complementation Data
 
Molecular Data
 
Affected Genes Inferred by Location (0)
    If no genes are listed here, it may be because the affected region is very large. The JBrowse insert above may show an error for the same reason, and other FlyBase tools such as CytoSearch may also fail for large regions. You can contact FlyBase for more help.
    In this case, the "Export to Hitlist" button at left will also be disabled.
    Phenotypic Data
    In combination with other aberrations

    Inferred to overlap with: Df(2R)ED1.

    Lethal in combination with Df(2R)ED1.

    Lethal in combination with Df(2R)ED1. Lethal in combination with In(2LR)DTD99.

    NOT in combination with other aberrations
    Stocks (2)
    Notes on Origin
    Discoverer
     
    Balancer / Genotype Variants of the Aberration
     
    Separable Components
     
    Other Comments
     

    Deletion extending from the 3' end of the P{lacW}GstS1k08805 insertion to a site within the coding sequence of the Ark gene. The P{lacW} element sequence is adjacent to the sequence GGTTTAGCAATTATTACTTTATTT within the Ark gene. The 5' and 3' ends of the P{lacW} element are present and non-rearranged (determined by DNA sequencing) and the w+mC marker within the element is still present (as judged by phenotype).

    Synonyms and Secondary IDs (6)
    Reported As
    Symbol Synonym
    Name Synonyms
    Secondary FlyBase IDs
      References (14)